EST 1209900 is a singleton


Sequence

>1209900 (1 EST) Length=317 GAACTAGTCTCGAGTTTTTTTNCGTGCGTATTTTGTTCATACACAACAACCGATTTTCTTTGTGGTCGCTTTATTCACTC TCCTATGTTCCTACTTAGTTGACCGATCGATTAGCACTTTNGGAGGACATCAAAAATTCATGTAAATAAATGAGAGCTAG CGCTAATGCTTATACTACCGCACCATCTAATCCACCATCTATTCGTCATGAACCAAACTCCAGTGTCTTTAGAAACTCTA TAGAAACATTCACAGAAACCTTACTTCTAGGCAACAGCATAGTTAACCCTGTTTCATCATTANCAAGAAGATGGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209900: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099002330189AA559493MC270420.NA3TBRI-Saber-cercaria-A


Date: 15:13:36 on Wed 22 Nov 117.