EST 1209901 is a singleton


Sequence

>1209901 (1 EST) Length=319 GTTGTTGACCATGGAAACATGTCTGAAGTTGTTGGAACCTCACTCTATTCGTCTGGAGTGTACATAGTCATCTNCTTAGG ACTTGTTATCACAATCGTANCCCTATGCGGTTACATTGCAGCTGATAAANAAAATATCTGCTTGATTGTGTCATATATAT TCATCTTATGCTTGCTCGCATTACTCTTGTTGATATCAGGAATAATAGTTTTGTCGTTTAAAAGTTCACTTGGTGAATCT GCTAGAAGTGTGATGGTAGCTTCGTTAAGGAATCACTATGGACNATATGGGATAATANCTGATGCATGGGACTTATTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209901: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099012330190AA559494MC270421.NA3TBRI-Saber-cercaria-A


Date: 1:12:25 on Mon 20 Nov 117.