EST 1209905 is a singleton


Sequence

>1209905 (1 EST) Length=313 GTTTAGCAGTTGCTTTCTTGAGCCGTATGTACAAAGCAAAAAAACGAAAACTCTCAGTATCGGAAATTAATCAGTAAATA GATCTTAAAATCACTTTACATGTCTGGTAACGTCTTACCAAGNGCCATACTACATGCTGTTTATGGAACTACAACTCAAC GNTTTGTTCCTCAATTACAGCGAAATAACACTAAAGTGCTGTAAATTTCGACATGATAGTCAAGGTGTCAGGGATTATAT TGAAAATCACTTAGTGGACTTTGCTCGAGATAATCCAGCAACTGCTATCTATGTTAAAGCCNCGAAAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209905: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099052330194AA559498MC270426.NA3TBRI-Saber-cercaria-A


Date: 18:56:23 on Sat 18 Nov 117.