EST 1209926 is a singleton


Sequence

>1209926 (1 EST) Length=222 TTGTGCCANAAATCATGGTTGCATATTTTGGGCTTCGGAGCGAACGGTTTATCGAACGCCGGAAACCAATATCTTTAGGC AATACGGACATTTTAAAAAGGTCTGCACCGCCGATTCATTGGGACTTCAATTAACATAAATGACCAGTNCTAGTTACNTA TTCNATTANTTTGTACCCTCCATGCCCCCTAANTTTANTGGAAATTACACATTGTTCTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099262330215AA559519MC070504.NA3TBRI-Saber-cercaria-A


Date: 14:19:14 on Sat 18 Nov 117.