EST 1209946 is a singleton


Sequence

>1209946 (1 EST) Length=237 CTTACTGTCTACTGTGCATCNATTCAAATGTTGTTTGGAATCANCATGCTTGAATGGTGTTTTATTGCATCAAATGAACT GACACTGGCTATGTGCTTGTTGTGTAAATGTGTTTTTTNATATTTGTGTCTATATACTTACTTGTATAGTATTTATTNCC CCCCNACTTGTCCTCTGACTTATATATGTGTATATGTATATAATGTCACCAAAAAAATAAATTACATTACTTGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099462330235AA559539MC070535.NA3TBRI-Saber-cercaria-A


Date: 1:27:41 on Sun 19 Nov 117.