EST 1209954 is a singleton


Sequence

>1209954 (1 EST) Length=307 GCCAAAGNTCAGTCTAACTGGACTCCACTTATGATTGCTGTTTCCGCTGGACGTGATAATGTAGCTTCATATCTTATAGA GCAAGAACACGCTGATGTAAATGTAGTAAATTCGACAGGTCAATGCTGTCTTCACTATTGTGCTTCTAAAAATCGTCCTC AGTTGGCCAAACAGTTATTAAATGCTGGTGCGAAACCANATGTAAAAGTTTGGGGNGGTGTTACACCGCTTCATCGTGCA ATCGCCACAGAAAAACCTANATATAGCTAAACTTCTTTTAGATCATACAGTTACTGAAGAANNACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099542330243AA559547MC070544.NA3TBRI-Saber-cercaria-A


Date: 19:16:1 on Thu 23 Nov 117.