EST 1209955 is a singleton


Sequence

>1209955 (1 EST) Length=311 GTATTCCTCCATGTTTTACATAATTTTTCCCCTAAAGTATCATTTATTCNTTCATTACTGTTAATTTTAACGAATAGTAC AGAGAGGTCAGCGAGAAAAGTAGGTTATTTTCCATATTTTCAGACTTTTGACACATTATTTTGGTTAAATTATAGTCGAA CAATATTCTCTCAGCTTTAGTTTTATTCTATCTTTCTTCTCTGACCTGTTATATTTTGCTTATTTGGAGGATTTAATATC AACTAAGTTATGAAGTTATCCGATCATTTATAAATTCATGTATGTTTATTTTATAAATATGACGAAAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209955: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099552330244AA559548MC070545.NA3TBRI-Saber-cercaria-A


Date: 16:4:37 on Tue 21 Nov 117.