EST 1209957 is a singleton


Sequence

>1209957 (1 EST) Length=191 GGTACTAATTTCTGTTGTAAATTGCTGTGTAAATTATAACATNCTTGAGTTAGTTGCTATTTTGAATTTTTTATCTCTAG NACTTAAAACTCCTAGTGTTTANNTCTTACTTGTACACTGAATTGTAATTATCATTCCACAAATTTCATTCATTCGCTGC TTATATTTTGNTTTTAATTCAANNAAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099572330246AA559550MC070548.NA3TBRI-Saber-cercaria-A


Date: 19:15:43 on Wed 22 Nov 117.