EST 1209976 is a singleton


Sequence

>1209976 (1 EST) Length=311 ATCAAACAATCATTTATTTTATTGCATGTCATTGTATTTNGTCCGCAGTCAACTCAACGACGCCACCCACCTCACCCCTC CACACACACACACACCTTATTTCACCTTGAAAACAAAGAGTATACAAAAATNCATTTTCACTGTATAAAAATGCTAGTAT ACCTACTATACAACTGTNTTTTGCCANAAAAAAAANATAAATTCAAATCTTTATTTCACTTAAAATATTTCNCATCTTTA TTGGTNTCTNCTATTTNNCATTGTTATNCNCTATTAGTAACATATACTACTATTTATCGTTCTATGATAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1209976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099762330265AA559569MC070574.NA3TBRI-Saber-cercaria-A


Date: 18:54:10 on Wed 17 Jan 118.