EST 1209987 is a singleton


Sequence

>1209987 (1 EST) Length=322 GTTCAACATAAAAGATTGTAAATTCAAAAATCTTTAAAGTATTTTATATTCTAGTAGAAGGACTCTTTACTTGAAACCAT TATTGTTAATGTGTTAATATCCTTGTAATTATTATTATTAATTACTAATTATAACATTGATGGCACTTGAAACCAGTAGT AATTAGTCTNCGCANAGCAACATCAGATAAATCCTGGGGATTTGTATTACAAGGTGGAGTTGATCAAGGCTTGCCAGTAT TTGTTCATAAAGTTACACGTAATGGGATAGCTCATAAGTCTGGACTTGAACCTGGAGATGTAATATTGAAAATATGCGCA AC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1209987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099872330276AA559580MC080503.NA3TBRI-Saber-cercaria-A


Date: 5:59:40 on Wed 22 Nov 117.