EST 1210020 is a singleton


Sequence

>1210020 (1 EST) Length=280 GCGGTTATNGTGGTTATTTANCTACAATGAGTGCATNGGCTGGTGGAGCAGATGCTGCTTATATNTTTGAAGAACCATTT ACAATNGATGATTTACGTGAAGATGTANTACATCTACGTGCAAAAATTGATGATAATGTTAAACGTGGTTTAGTACNACN AGCTGAATATGCTAATAAATACTATNCAAGTGAATTTATNCNTCAATTATATGCTCAAGAAAGGTCAAGGTATATTTGAT TGCCGTTGTAATGTACTAGGTCATATGCAACAAGGTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210020: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100202330309AA559613MC080553.NA3TBRI-Saber-cercaria-A


Date: 12:10:38 on Mon 20 Nov 117.