EST 1210021 is a singleton


Sequence

>1210021 (1 EST) Length=316 CGGCACGAGCCGCCGTCTCTGCATATGGAACGACCTACTTCATCGTGCTTTTGTCGAGGATGGAGAACTTGATGTACGCC GGACTCATTGGCGCCGCTCTCTTCATTGCATATCTCGTCTTCGGAAGGATNAAGGACAGGCTCCTGATCGCAGTGTCGAA GGCCGANATGACAAGTCTTGGATTGGTGGCATTCGTCAATCTGTGGGGTATCATTGACATATTCGGAGGGATGCACGGAA ATGAACAACCCGGAAAAGGCATTGGATGTCGGGCTCCTCATAGGAGGTATCATCATTGTCATCACCTTCCCGATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100212330310AA559614MC080554.NA3TBRI-Saber-cercaria-A


Date: 7:18:33 on Mon 20 Nov 117.