EST 1210025 is a singleton


Sequence

>1210025 (1 EST) Length=295 ATGTCAGTTTTATTTGACTCCAGGAGTAAATAAATTGTGATGTNAATTTTCATTTNCTTGTAACTGCTTNGTGCNTTATA AACGTTCACTGTGTTGTTAACTTCTGTTTCATATTTACTTAAAATATATCAAATTATTNTGAAAACAGAATGATTGTAAC CNATCTNGTACTGTNTTATTTATCAATAATACGTTTCATGTATATGTAACCATTAATATCGTATATTTCTCTTCTTCTCC TNGAGAGTCCATCATGGCATNCGAGTTGCGAANAATACAAGTTTAAACCAAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100252330314AA559618MC090701.NA3TBRI-Saber-cercaria-A


Date: 14:40:41 on Tue 21 Nov 117.