EST 1210031 is a singleton


Sequence

>1210031 (1 EST) Length=322 TCAAAGTCAGCCAATATTTTACCATGTTTCCAGTCTAGATGGTATGACAGAGAATGGAAATGTTTTCAAAGTCCTCGGTA ATTTGAACCCAACTGCCTCGGATCTCAGTTTATCCATTGTCAATCCTATATCATCGAGTCGAATTAGTGAACGAGATGTT CGCTCCCTTCTTTCAGATGCTTTAAAATTGTAGTGATAAACATTTTTCTACTTCTAAATATTCCACAATCCCTCTAAGAC AAATGCCGATTTATACACTTGTTTATAATCACTGTTTTCACTGCACCGTNCCTTTGTTATTGATTCAGTGAATTCAGTGG TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100312330320AA559624MC090711.NA3TBRI-Saber-cercaria-A


Date: 21:28:13 on Fri 24 Nov 117.