EST 1210035 is a singleton


Sequence

>1210035 (1 EST) Length=306 GTCAAGTAGTTATGGTATTGGGTGCAGGTCGTGGTCCCCTTGTCAATGCGACTATAAATGCTGCTGAAAGAGCTCAATGT AAAGTTCGGATATATGCAGTTGAAAAAAATCCAAATGCATTATGTACATTACGTTCTAGGATAAATCATGAATGGCAAGG ATTAGATGTACAATTAATTGAAGGTGATATGCGTAATTTAAAAACACCAGAACAAGCTGATATATTTGTCAGTGAACTAC TTGGTTCATTTGGTGATAATGAATTAAGTCCAGAATGTTTAGATGGTGCACAACCAATGTTAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210035: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100352330324AA559628MC090718.NA3TBRI-Saber-cercaria-A


Date: 2:7:1 on Wed 22 Nov 117.