EST 1210037 is a singleton


Sequence

>1210037 (1 EST) Length=302 GTTTCTTAATCTGATCTGTCCACNAATAGAAATCGATTTCTACCTGTTACTATTATTATTATTACTATTATTATTGTTAC TATNCTGTAATGTTCGGCTGTACCATGTGTTGTTGTTCAAAACATAGCTNCTNCGGTTNCTTTTAGTTTACTGGAATGTT TGCTTTGTGCATGTATTTCATTTNGGTCTGTTCATATGATNCGAACGTGTTTTCAAGTAATGAATGTTGACAACTTTTAC TGTGTGCAGACTGTTTAGTGAGACAACTGGTGTTTTACTTTGCTCGAGTAAGTTGAAGCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100372330326AA559630MC090722.NA3TBRI-Saber-cercaria-A


Date: 20:1:27 on Sat 18 Nov 117.