EST 1210041 is a singleton


Sequence

>1210041 (1 EST) Length=314 CTCGTGCCGCAATACCTGGAAGGTGAACCTGTCCATGATTTCTTCAAGATATTTGTCTCTGGAGATCTGAATACATCCAG AAACTTCCTGACTAAACATCCAAACTTTTTAAATCAAAATAATCTATCTGAAGAAGCTTGTATTCACAAACTCCGACTTC TGACGCTAATGCAGTTGTCTGAGAATGTGAATGAACTTAGTTATCAAGATGCAGCTGCTCAGTTGAATCTCAAGATTGAA GAACTGGAACCATTTATAATAGAAGCTGTACGCCAGANAGCTGTCGCATGTTAAATTAGATCAAGTTCAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210041: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100412330330AA559634MC090730.NA3TBRI-Saber-cercaria-A


Date: 8:13:52 on Wed 22 Nov 117.