EST 1210043 is a singleton


Sequence

>1210043 (1 EST) Length=314 GTTCACCAAGGNAAATGTCTGGATCTCGCAAATTTTTTGTTTGGGGGGAACTGGAAAATGAACGGAAGCAGAGATGACAA CGATAAGTTACTTAAGTTACTCTCAGAAGCTCATTTTGATGATAACACGGAAGTTTTAATTGCTCCACCTTCAGTCTTTT TGCACGAAATTCGAAAAGGTTTGAAGAAAGAAATACACGTGGCCGCTCAAAATTGCTATAAAGTATCAAAGGGTGCATTC ACCGGAGAAATCAGCCCAGCAATGATAAAANATATTGGTTGTGATTGGGTCATACTTGGGACATTCTGAGCGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210043: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100432330332AA559636MC090740.NA3TBRI-Saber-cercaria-A


Date: 17:12:26 on Fri 24 Nov 117.