EST 1210051 is a singleton


Sequence

>1210051 (1 EST) Length=315 GTGATTTGTTGCATGATGTCATCTTATATATGATTGTAATGCAACGTGCACGAGCCTTGAAATATATTTAAAAAACTNCA CCGTACATGTGAAAATGTATTTAAAGATGATATCGAAACATTACAAAACGCCAGAGAAAAGATTAATTCGGAGTTTCGAG CTAATCGAAATGAAACTGATGCAGAAAAAAATAAACGAATTATTGGTAAAAGCAGAAGATTGTGAAATACTAATCAGAAC AACAGTTATTCAAATGGAAACTCATCGATGCTGAGAAAAATGTGTATAGAAATGGAATCTNCGTGACGATTTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210051: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100512330340AA559644MC090750.NA3TBRI-Saber-cercaria-A


Date: 12:0:22 on Wed 22 Nov 117.