EST 1210055 is a singleton


Sequence

>1210055 (1 EST) Length=306 CTTCACGTTGGTGTTGTGAAAAATGAGCAGGGTACCTAAAGTTTTTGGCAAGACCTATGCGACTCCGCGAAGACCGTTTG AGAAGGAGCGTTTAGATCAAGAGTTAAAGCTCATTGGTGAATATGGTCTGCGCAACAAACGCGAAGTGTGGAGAGTAAAA TACGTCTTAGCCAAGATACNTAAGTCAGCCCGCGAGCTGTTGACACTGGGATGATAAAGACCCCAGACNACTTTTTGGAG GTACCAGTCTTACTTTGTCCTTCATTTTAAGGGTCCGCTCTGCTGANACGCTTAGTTCGAGTTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100552330344AA559648MC240706.NA3TBRI-Saber-cercaria-A


Date: 2:11:39 on Wed 22 Nov 117.