EST 1210060 is a singleton


Sequence

>1210060 (1 EST) Length=317 TGTTGATCAGAAAACACCAGAGGCCGTTATTTGTAAAGATTTTGATAAATTTGAGATGCTCTTGCAGGCTTATGAATATG AACATGAAACACTTGAACCAGGAAAAATTAGAATCATTTTTCGAAAGTACCCTAGGAAACATTTAGCACAAGCCTTGGTC AAAAGTGGGTCANAGAACTGTGTTCATTGCGGAGAAATTTATTTATTCAGTGTGAATCTAGTGATACTTAAAGGTGGCTA GCAAGTGCCTCAATTTTTACNAGACTTCTAAATGATGCTCTTTTTCTATGCATTTAAATACTTCTTCGTACTTCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100602330349AA559653MC240719.NA3TBRI-Saber-cercaria-A


Date: 21:56:13 on Fri 17 Nov 117.