EST 1210064 is a singleton


Sequence

>1210064 (1 EST) Length=290 CCATGTCCAAAACGAGTTGGCTCATCTACAAGAGCCACAAAACCATAAGAGTTTAACAGAAAGAGAAAGTTATCCTTGTC AGTAGAATGAGACAATAAATTAATATTAAAATCACCCAGCACAAAGACGTCACCAAAATCACTCAATGAGTCCAAACAAT CTTCAAGCTCATCAAGAAAAAAAGAGATGGAGTGAGACTGCAAGCGGTAGAAGCACACGAAATGAACAGGTCTCCCAAAA ACCATACNTGAAAAGGGAGAGACAATCCGCAGAGACNAGTGAATGCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210064: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100642330353AA559657MC240732.NA3TBRI-Saber-cercaria-A


Date: 2:13:38 on Thu 23 Nov 117.