EST 1210066 is a singleton


Sequence

>1210066 (1 EST) Length=279 CTCGTGCCGCTATACTAAAACAGTCCATATTTTATCAGCAATGCTATTTCTATACCATAACACTATCACTAGAATCCAAA ACTCTAGTTATAGATGTTTTTTAAGACAAATGTTTGTACAGTGTACGAACTTATGTAAAAAAAGAGATTTCAATGGAACT ACGAAAGGTACGGAGTGACTGAACTAGGTGAGGTGATTTATAATAAAGCTTGCTGTGTATGACTACCCATGGTCAATCAA CTATACTCTTTGGTTGAAATACACTATCCTTAATTAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210066: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100662330355AA559659MC180901.NA3TBRI-Saber-cercaria-A


Date: 10:10:27 on Wed 22 Nov 117.