EST 1210068 is a singleton


Sequence

>1210068 (1 EST) Length=254 CTGCGTGACAATGAGCCACATTAGGAAGTATCCTGTCTGCGTTGGTCGAGAGAAAGGTCTCAAGAGAACAAACAATATCC GTCCTAAAAAGCCTTCAAACAGAAGAGGGCGTTTAACCAAACAAGCAAAGTTTGCACGAANTCTAATACGTGAGGTNGTG GGCTTTGCTCCATTTGAGAAGCGTATGCTTGAGTTGCTGAAAAACGATAAGGAAAAAAGGGCACTCAAATTCGCTAAGCG TCGCATTGGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210068: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100682330357AA559661MC180904.NA3TBRI-Saber-cercaria-A


Date: 22:57:5 on Wed 22 Nov 117.