EST 1210069 is a singleton


Sequence

>1210069 (1 EST) Length=261 CCAATTTTTCTCCAATCTATTTTTTTGTTGCTTCAGTTTATNAATTAAATGGTTATGATTATTTNCTTAAATGTTAATCA ATGTGAATTGATTCGTTTGTTTGTTTATTTATTTATTTTNCTGTTTATTTGTTTATTTTGTCCGTGTGTGGGTGTGTGTG CGTGCGTACGTGCTTGTGTTTATGTCTGTGCATTTGAGTTGGGATAATTATTAGTAATAATAAACTCTTAAAACAAAAAA ATAAAATGATTTAGATACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100692330358AA559662MC180905.NA3TBRI-Saber-cercaria-A


Date: 23:15:49 on Mon 20 Nov 117.