EST 1210070 is a singleton


Sequence

>1210070 (1 EST) Length=323 TACTTCTTCTGGATACCAATAGTTGGACCGTATATTGGTGCTGTCATTGGTGGAATCTTATACGAAATGACTACGGTATA CATTTGGATAGGAAATCCGATTTCGTTGTGGATGTTGATTATGATGATTCACATCGTGAATGGTAAGAAGTTGGTGGCCT ATTCATCACCGTAATCGTTGACAACCAGAAGTAATCCTCAAATGTATCCTACTTTTACACGAACACACACACACAAACAA CACACAACACATACACTCTTCCATTACCGTTGAATGAATCACAACCATTTCCACTATTTCCATCATTCAGATTTCCTAAA TAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210070: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100702330359AA559663MC180906.NA3TBRI-Saber-cercaria-A


Date: 22:50:17 on Wed 22 Nov 117.