EST 1210081 is a singleton


Sequence

>1210081 (1 EST) Length=280 GCTTGCTGACACTGACGTGGTAGTTAAGATATAACGTTTGTTTTACACACAGAAAACGGGGTTTAGTATTGCTCCCAGCG TTATTTTGTTTGTTATTGTAAATACATAGGTAGTGAGAGGTTATTATAACNTTNACTTAGTTAGTATNCCTTTTATGTTN NTATTAGGTNTAAAGTNAGTGTTGTATGTTATGTGATATATAATTAGAGGTACTGGTTTATGTNNTATANTGTGTTATAT TATGCTNTTTTTNAGTGAATACTGTATTATGTGTCGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210081: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100812330370AA559674MC180923.NA3TBRI-Saber-cercaria-A


Date: 11:12:50 on Sun 19 Nov 117.