EST 1210094 is a singleton


Sequence

>1210094 (1 EST) Length=307 GTTCACTAAGAAGTCATGAATTTCAAGTTCAAAGAGACCCATACCTTCGAGCAAAGACAGCAGGACTCCTCCAAAATCAA GGCCAAGTATCCTAACAGAGTTCCAGTCGTCGTGGAAACGTCATCGCCATTCGCAAATACCCGATATTGACTAACATAAG TTTCTTGTTCCGGATGATGTTACAGTCGCTCAGTTTATGTGGATCATTCGAAAACGTNTTGATATCTCATCAGAAAAAAG CCCTTTTTCTTTTTGTTGAGAAGAATATGCCTCAAACAAGTGCCCCAATAGGGTCAACTATATCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210094: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100942330383AA559687MC180948.NA3TBRI-Saber-cercaria-A


Date: 11:48:45 on Thu 23 Nov 117.