EST 1210095 is a singleton


Sequence

>1210095 (1 EST) Length=124 TGAAAAAAATATGTATCAAAGATAAACATACCTGAATACACACTTATTGTATTATATATATATGCATTGTTTTGCTTTGA TACATATTTTTNCAGAGTAGTAATAAATATTTGTTTTANTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210095: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100952330384AA559688MC180950.NA3TBRI-Saber-cercaria-A


Date: 18:52:29 on Sat 18 Nov 117.