EST 1210101 is a singleton


Sequence

>1210101 (1 EST) Length=218 TTTGTGTGCGCTATTGATCAGACAGATAATGAATTAATTACATTGGAGATTATTCNTCGTTATGTGGAGATTCTGGATAA ATATTTTGGAAATGTCTGTGAATTGGACATAATCTTTCACTTTGAAAAAGCTTATTTGGTTTGGGATGAATANTTACTAN CNGGTGAAGTACNAGAGACNGGAGCGAAAGAAATTCTTNCNGTGATTGANGCACAANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210101: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101012330390AA559694MC031026.NA3TBRI-Saber-cercaria-A


Date: 14:32:32 on Fri 17 Nov 117.