EST 1210102 is a singleton


Sequence

>1210102 (1 EST) Length=313 GTGACTAGTTAGTATATNGTTGTTTATTGTTAACTATGCAAATGTGTGGTTATTTCTTTCCTGTGATAGAGTTAGTGGAC AAGGCGAGCTGTGGATGATAGGTGATGAATTTGCAATGAACAATGATGGAATCNCTAGTCTCTGTGATGATTGTAGGAAT GTAGATGTTTGTNGTANTTGAGGAGAAGGTGTTGTGATCAGTNTACGACCANTAGTGGATCAACAANTNAGCTTTGAGAC ATGTCAATGCCTTGACNNGAGAACTGAANTCTTTGGGTTTGTGGACTGNCANTGAGTGTGTGAGTAATCCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210102: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101022330391AA559695MC031032.NA3TBRI-Saber-cercaria-A


Date: 21:11:10 on Fri 24 Nov 117.