EST 1210103 is a singleton


Sequence

>1210103 (1 EST) Length=317 AGACTTCATTGAAATGAGTACTGAGCAAGAAATTTTAGAGACAGGCATCAAGGTTGTAGACCTGTTAGCTCCTTATGTGA AGGGAGGAAAAATCGGTCTTTTCGGTGGTGCTGGGGTTGGCAAAACTGTACTTATTATGGAGCTAATCAATAATGTTGCC NTANTCTCNCGGAGGTTACTCTGTGTTTGCTGGTGTTGGTGAACNTACTCCAGAANGCNATGATTTATNTCCCNAANTGA TAACNACTGGTGTGATTGACCTTAAAGGAAACNATTCTNAGGTGTCTCCTGGTGTACGGGCCNATGANTGAACCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210103: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101032330392AA559696MC031033.NA3TBRI-Saber-cercaria-A


Date: 12:6:56 on Mon 20 Nov 117.