EST 1210104 is a singleton


Sequence

>1210104 (1 EST) Length=173 TGCACATCACCCTCATCAAAACCTTATTGCTACTTATTCAGAAGATGGTTTAGTAAAACTGTGGNAAACCTTGAATGATG GAAAATTCTACTATTATAATGCGAATTTCGAATGTNTATTATTGTTGTTTCTTCGTNAACGATACATTAAATAAATAACT TTCTTAATTTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210104: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101042330393AA559697MC031035.NA3TBRI-Saber-cercaria-A


Date: 21:13:23 on Sun 19 Nov 117.