EST 1210106 is a singleton


Sequence

>1210106 (1 EST) Length=178 AGACAGTTTAAATCATGTAGAGCTTGTCATGGCAATAGAAGAAGAGTTCAATATTGAAATCCCTGATATGGATTCTCAAC GTTTCCTCNCTCCCCNAGATATCNTCCAGTATCTATGTGATCGGCACNATGTCTNCGATTAGTGATTATAGTTCCAAACA CTTGTTTGTTTGTNATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101062330395AA559699MC031038.NA3TBRI-Saber-cercaria-A


Date: 14:7:1 on Fri 19 Jan 118.