EST 1210111 is a singleton


Sequence

>1210111 (1 EST) Length=296 TGCAAGTGATCCACATTGGTACATGTCCACGTATGAAATCTGTTACATCATTGTGTGTTGAGTGGATGATTTTGTTAGCT GCATTGACCGGGATTAATTTAATTGCAATATGGAGAAAATGGTCNATATTTCCTGTTGCTAAAACATATGGAAACAATCC TTATGAACTAGACTTTTTGAAAAATTTCACTGATTTATAATTTTNGTAGTGGTACATTAGTTAAAAGTAGTACATATTTT TTAAGTAAAAATATTGTTAGATTGACGAAGGTTGCTAGTTTTTGTACACTGCNCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210111: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101112330400AA559704MC031052.NA3TBRI-Saber-cercaria-A


Date: 0:56:20 on Wed 22 Nov 117.