EST 1210116 is a singleton


Sequence

>1210116 (1 EST) Length=321 CTATGCTGTCCGTGTACCGGAAAGAATATTTCCTGGACGTTTTGATATTTGGTTTCAAAGTCATCAAATATTTCATGTGT NCGCGGTGGTTGCAACTTTAGTTCACTACCACGGCTTAGTTAAACTTGCCGATTACCGTCTATCTACTGGCGATTGTAAA CCTGTTGGACTCNATTTCGATTCAAATCAATTAAAAATTTTCGGTCTGGATATATTTCCTAACACATTATGATCAACTAT TTCCACAGTATGACAAAATTATTATTACAAGTGATTACGCACTTGTGATATGTGCATGTCTATTGAACTGATCATCTATC T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101162330405AA559709MC031061.NA3TBRI-Saber-cercaria-A


Date: 20:41:5 on Thu 23 Nov 117.