EST 1210118 is a singleton


Sequence

>1210118 (1 EST) Length=325 GTCGGGACTCGGTCTGTANTCCGTGCGTAGAACGGCTCTGGTTCCAAACGCAGGCAAATCAGGCCACAGCTTGACAGTGC GGAGCCAAACATCAACTAAATCTTTACATCCAGGAAGTGAACTCGTCAGACCATCGAGGGCCTCAACTGCTCTCCATGGC GAACCAGGATCACCCTCACGTACGGGAAGTGCTAAAGTTCGACTTTCTTCTTCATTATACGTCCAGTCGCTGTCAACAGG AGAGTTGGGCANAGGCATATACCTCAATGTTTTGCTGAATAAGTAGTACAGTGGCCCATGTTAAGATACNCATAAGCCAT AAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210118: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101182330407AA559711MC031065.NA3TBRI-Saber-cercaria-A


Date: 4:15:36 on Wed 22 Nov 117.