EST 1210119 is a singleton


Sequence

>1210119 (1 EST) Length=310 AAATTTACAATCNNCAAGTGGAGTCGTTGGCATTGGGATTGTAGGCTTAGCCGTGCCTGTATATGCATCAGGCTTACAAN CNCATCCTGCAAAACTACCTTGGATACACCATGGGATATTATCTGCTTACGATCATGCTTCTATGCGTCNAGGTTATCAA GTATACAAAGAAANTGTGTANTGCTTGTCNCACCTTGCAANTATATAANCTATCNATATTTAGTCAATACAGTACTCACA GAAGAATGAGGCTAAAGCGGATGCAGCTGAAACATATGTATCCTGAATGGAACCGGGATGATAATGGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210119: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101192330408AA559712MC031067.NA3TBRI-Saber-cercaria-A


Date: 12:47:18 on Sun 19 Nov 117.