EST 1210125 is a singleton


Sequence

>1210125 (1 EST) Length=246 AAAGTCATATGGCACGATTTGAGAAAAANGGAAGGTGGACATNCACTTTCTTCTTTCCGTAGTCAACTTAAGTCAACCGG TCATAGTAAGTACGCTCTGGAGGAAAAGGATGAAGTCGCGAATACACCTAAATAATAGTTTACCTTATGAAGTANCAGTC GGTATTTACNTTCATTAAATAAACTTTTTATATAATTGTAAAACNTCAAAGAGAACNACANTAAACTTAACTGATAGATA CTTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101252330414AA559718MC031079.NA3TBRI-Saber-cercaria-A


Date: 4:13:3 on Thu 23 Nov 117.