EST 1210126 is a singleton


Sequence

>1210126 (1 EST) Length=322 TACGGATAAAAGTGGTTCAATGAATTCGATTGAAATTAAGAAAATGCATTGAAAACATGTTGGTTTTNCCATTAATAATG CAACATTTNCTACATNGGTATTACGTTTTNCACGTCGTGATGGTAGTGTACCATTTGATAGTTATGTAATATGTTGTGCA CGTTTACAAATCTTATTTGAAGTATTTAAAGCAACACCTAAAAATGATCAATTACAANCATTATTTACTGAAAGTGAATT TGTAAACAGTGCACTCTATATGTAATCAACTAATATAGATAGACAGATTCANCTATTTCTTTGGGAAATTCATATATTAC CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210126: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101262330415AA559719MC031081.NA3TBRI-Saber-cercaria-A


Date: 4:40:37 on Wed 22 Nov 117.