EST 1210128 is a singleton


Sequence

>1210128 (1 EST) Length=324 AAAGANTATTCATCGTTTATAGTACATGGGTTAGCAATGATAACCATGTATGTAATCACAGCGTTACCGTGAGTGACGCT TCACGCGAAAGTCATCTATACTGTCCAGTAATTTAAACCATTATACTAGGGACAGCAACATTGCGATATGCTGATACATC TTGTCTGTATTCAATTTTATTGAATCACAGTTATTCATCAACTTAATGTACTACCAATTACATCTGGTGCCACCGATTTG CGAACATTAACTGGAGTAATCCTATTATTGTAAGTGACTGTNGTTCAGTCATGATTTTTTGCTCCTGTATTGTTTGTGGA TTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210128: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101282330417AA559721MC031087.NA3TBRI-Saber-cercaria-A


Date: 11:37:8 on Fri 24 Nov 117.