EST 1210129 is a singleton


Sequence

>1210129 (1 EST) Length=319 TTTATGTTTTTACTATTCCATATTGTGATGTATATTTTAATTCATTATCCATCCTTAATCCAATATCTCTGTATGCATTT TCATTGTTGATTTTGATCATTTATGGAGTGAAAAAAAGGAGAGGGGAAAGGCACAAAGAGATATATGAAGTTTGATGATT GTGAATAATCGATTAATCTGTCTAATCTTTTTTTTAAATTATTTTTCTTTATATTANCTATACTACTTATAAAAAACCAA TCATCTGAGTGATATAATTTCGTTTATTATGAGAATTATCATAATCCTCTTTTTGTGTATATTTATGCAATACATACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101292330418AA559722MC031090.NA3TBRI-Saber-cercaria-A


Date: 11:57:58 on Fri 24 Nov 117.