EST 1210130 is a singleton


Sequence

>1210130 (1 EST) Length=320 GGTTGAAGCCAAAAAATGAAGCGCTTAAACATCGGTTAGAAAGCCGTAAAACGTTTACGTGCGTCTAATCAAGCAAGTGT TCCCGGTACAATTGGGGAGGAATTAGCAACCAATCCTTTCATGCGTGTTTCTGAACCAGATGTGCTTGCACATGCGAAAA CTACAGATCCCATCAAAGCCATGAAGACAATTCGTGAAGAAAAAGATCGCTTTTAGATTTAANGGTCATCTGTCTTAAAC CAGTGATGTATTACAATTTCTTCAATGAAGTTAGTATGCCCTTTTACATTCTTATCTTGACCCTGAACATAGATGAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210130: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101302330419AA559723MC031091.NA3TBRI-Saber-cercaria-A


Date: 2:42:19 on Sat 25 Nov 117.