EST 1210137 is a singleton


Sequence

>1210137 (1 EST) Length=321 AAAAGTCAACTGAAACCTTTTCTGTGCAGTGTGTCCTATTCTTCGTGTCATAATCAATCATCATACTCAGNAAACGGTTC TTGTCACCCAGAAAACGTACATTTGTAGTTTATCTGAGTGCCTTTNCAGCTATCTGAATATGTAATAGATTGTCTTTTNC ACCATATAATTGAACAGTTATCTGCTAATAGCNCTCTGATTCCAAGAAAGCATTCAAGTTTCTCTCCAAATAATAAAGAA AATCATTGCNGGCAATCTTCAGAGTTTCTGGGAAGCAAAATGATTATTCGGAAACTAAGACTGGANTGCACTTCAAAGAT C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210137: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101372330426AA559730MC041006.NA3TBRI-Saber-cercaria-A


Date: 14:37:1 on Sun 19 Nov 117.