EST 1210159 is a singleton


Sequence

>1210159 (1 EST) Length=282 CAGCATTCTTCATCCAACTCTGTCTTGGGCCTNCCTTTCCAGTTTTAAACGAATGAATTTATCCTAATTCGTTGGGAATA NATCTAATCATTCATGTTATTTGGTTTATTGGTTGTGTTATTATATGTATATTTGGTTAAATTTTTTTTGCTTCGGTGAA TGAACAATGTTCTCATTCTAGTATNCTGCGTACAAATATTAAGTGGTCTTTTTTTTAAAAAAAAAACAAATTATTGTTTA NCAATTACCATTNCNAAATATNTACAACAAATTGGCNTCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101592330448AA559752MC140329.NA3TBRI-Saber-cercaria-A


Date: 10:33:36 on Mon 20 Nov 117.