EST 1210160 is a singleton


Sequence

>1210160 (1 EST) Length=310 GATGATTTNGCTTATTTTNTCCATGTGGTTGAAAGCACATTACTCCAAATCTACCGCAAATGAGTCATATGATCATGGNA AAAGAAATTGNAATACTAATTTGGGATAAAAATATTAAAATGTATTCCAGAAATTAGGTAAAATACTTGGAGACAAATTA CATGTATGTATTTGAAAAACAGTAATATTCAAATGGAAATATGTTATGCAAATTGGAAAATAAACCAGGTGAGTTAATAA TTAATGGTAGCTAAANAAACGATCTGGTTGAATGTTTATATTGAATTGGAAAATCGTGGGTTTAGGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210160: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101602330449AA559753MC140330.NA3TBRI-Saber-cercaria-A


Date: 11:54:53 on Fri 24 Nov 117.