EST 1210161 is a singleton


Sequence

>1210161 (1 EST) Length=310 GTTTGTCTCCGCCCTTTTGGTTTCTTGTTCGGTTTTCTGGGCCCTGTTTTTTGTACCGAAAGGGACCCAACAAAATGCTC TTGTCTGTATCGATTGGTACTCACCGCTGTCTGTTGCTATTTGTTTTTGGATAGGATTTTACCTTGCACAGTACCATCCT TTTTTCGGACCTTCATTGAAAAACAGGATCTATAANAAATTATCCAACAGCAGTGGGACGCGCAAATAGATTTGAGAAGA AATCTTATCTCAAAAGTACAATTTTGGTGTTACAATTCAATTGAAATGTTTACTTCTCTCCGTGGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210161: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101612330450AA559754MC140331.NA3TBRI-Saber-cercaria-A


Date: 13:19:22 on Thu 23 Nov 117.