EST 1210165 is a singleton


Sequence

>1210165 (1 EST) Length=312 AATCAACTGCACCATCTAATATCAATAACATCAACACTACTATTTCTTCTATTACTGGCTCTACAACTATTCAGCATACT CATCTCGTCAGTGAAACATTCATCATCATCGAAATTCCATATCATCTGAATACAGATCAAGTTGAGTATACATCAAAATC AACATCATCATCTTCAGATGCACTACGCAGCTCTAGTCCCTAATCTTATTGTAAATCCATATGTTACTGAATAATTTATT TGGTTGTGAAAGTTTATATACAAAGAAAAATATCAACCAACTACTTACTTTTTAATATATTATGGGCTGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210165: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101652330454AA559758MC140338.NA3TBRI-Saber-cercaria-A


Date: 12:30:48 on Sun 19 Nov 117.