EST 1210168 is a singleton


Sequence

>1210168 (1 EST) Length=207 ATTGACATGTTTGTTTTTTTCTAATTCTTCTTATATTGCTTTTGTCACCATACATTCTGNACTGNACATTTGTTATGTAC TGGTTTTTTTTTCCTAAATGTTTCCATATACNACNAACCTTNGTTTTNATCCTNATTTACTTNGTTAATNAATTTGGTTN AAAATTCCTTCCATTGTGTATTTTTTACGTGGAAATGATTATGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210168: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101682330457AA559761MC140342.NA3TBRI-Saber-cercaria-A


Date: 7:41:29 on Sat 18 Nov 117.