EST 1210175 is a singleton


Sequence

>1210175 (1 EST) Length=270 CTTGGAGTCTGGAGTTGACAGTAATAATCCTCACCCAACTGTTATTACAGAATGATGATGAAGCTGTTTGAAATCAATAC TTTATTGTTATTCTTAATGTTGTCCAGTTTTTATCCCTTGCCTTCAAGAATAAATGTATGTATATATGTATACCACTACA GAAACAAACTTCGTCCTGTTTAACAAAACTCACCCATAACGTGTTTCTTCAATGTTTTTATTTTCTCACAATTATGCTAT GTTATCAAAAACGTGTGTTCATAAAGTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210175: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101752330464AA559768MC210210.NA3TBRI-Saber-cercaria-A


Date: 17:1:54 on Thu 23 Nov 117.